=================================
KAPA SYBR\ |registered| FAST qPCR
=================================

Protocol
---------------------------------

Any existing qPCR assay performed efficiently using standard cycling conditions may be converted to a fast qPCR assay with KAPA SYBR FAST qPCR Kits. Typically, re-optimization of reaction parameters is required.

qPCR is performed at the MIT BioMicro Center on a Roche LightCycler 480 using SYBR Green MasterMix. Roche's documentation is `here <../../_static/files/roche_light_cycler-manual.pdf>`__.

.. tip:: 
    To do qPCR with HEK293T RNA, use about one million cells as input to the Monarch Total RNA Miniprep Kit and elute into at least 50 µL. 
    Be sure to do the optional "on-column" DNase I treatment to prevent contamiantion with genomic or plasmid DNA.
    cDNA can then be prepared using the ProtoScript First Strand cDNA Synthesis Kit with oligo-dT primers.
    Include a control without reverse transcriptase to ensure qPCR amplification is not coming from residual DNA.

1. Master Mix Preparation
---------------------------------

#. Ensure all reaction components are properly thawed and mixed.
#. Prepare a master mix containing the appropriate column of all reaction components common to all or a subset of reactions to be performed.
#. Always include a No Template Control (NTC) to allow for detection of contamination of reaction components.

    .. tip:: 
        If applicable, include a water control and a no reverse transcriptase control.

#. Calculate the required volume of each component based on the following tables:


+------------------------------------------------------------------+-----------+-----------+-------------+
| Component                                                        | ROX       | No ROX    | Final conc. |
+==================================================================+===========+===========+=============+
| PCR-grade water                                                  | N/A       |           |             |
+------------------------------------------------------------------+-----------+-----------+-------------+
|| KAPA SYBR FAST                                                  || 10 µL    || 10 µL    || 1X         |
|| qPCR Master Mix (2X)                                            ||          ||          ||            |
|| Universal (order from BioMicro Center when reservation is made) ||          ||          ||            |
+------------------------------------------------------------------+-----------+-----------+-------------+
| 10 µM forward primer                                             | 0.4 µL    | 0.4 µL    | 200 nM      |
+------------------------------------------------------------------+-----------+-----------+-------------+
| 10 µM reverse primer                                             | 0.4 µL    | 0.4 µL    | 200 nM      |
+------------------------------------------------------------------+-----------+-----------+-------------+
|| Template DNA                                                    || As       || As       || <20 ng     |
||                                                                 || required || required ||            |
+------------------------------------------------------------------+-----------+-----------+-------------+
|| 50X ROX High/Low                                                || 0.4 µL   || \--      || 1X         |
|| (as required)                                                   ||          ||          ||            |
+------------------------------------------------------------------+-----------+-----------+-------------+

2. Reaction Setup
---------------------------------

#. Transfer the appropriate volumes of qPCR master mix, template, and primers to each well of a PCR plate/tube(s).
#. Cap or seal the reaction plate/tube(s) and centrifuge briefly. The BioMicro Center has a centrifuge for this.

3. qPCR
---------------------------------

#. If applicable, select fast mode on the instrument.
#. Confirm that the qPCR protocol to be used conforms to the following parameters:

+--------------------+---------------------------------+------------------------------------+
| Detection Format   | Block Type                      |   Reaction Volume                  |
+====================+=================================+====================================+
| SYBR Green         | 96 well                         |  10 - 25 µL                        |
|                    +---------------------------------+------------------------------------+
|                    | 384 well                        |  3 - 20 µL                         |
+--------------------+---------------------------------+------------------------------------+
| **Program Name**   |  **Cycles**                     |  **Analysis Mode**                 |
+--------------------+---------------------------------+------------------------------------+
| Pre-incubation     | 1                               |  None                              |
+--------------------+---------------------------------+------------------------------------+
| Amplification      | 40                              |  Quantification                    |
+--------------------+---------------------------------+------------------------------------+
| Melting Curve      | 1                               |  Melting Curves                    |
+--------------------+---------------------------------+------------------------------------+
| Cooling            | 1                               |  None                              |
+--------------------+---------------------------------+---------------------+--------------+
| **Program Name**   | **Target (**\ |degree|\ **C)**  | **Aquisition Mode** | **Hold**     |
|                    |                                 |                     | (hh:mm:ss)   |
+--------------------+---------------------------------+---------------------+--------------+
| Pre-incubation     | 95                              |  None               | 00:03:00     |
+--------------------+---------------------------------+---------------------+--------------+
| Amplification      | 95                              |  None               | 00:00:10     |
|                    +---------------------------------+---------------------+--------------+
|                    | Primer dependent                |  None               | 00:00:20     |
|                    +---------------------------------+---------------------+--------------+
|                    | 72                              |  Single             | 00:00:01     |
+--------------------+---------------------------------+---------------------+--------------+
| Melting curve      | 95                              |  None               | 00:00:05     |
|                    +---------------------------------+---------------------+--------------+
|                    | 65                              |  None               | 00:01:00     |
|                    +---------------------------------+---------------------+--------------+
|                    | 97                              |  Continuous         | 5-10 acq/    |
|                    |                                 |                     | \ |degree|\ C|
+--------------------+---------------------------------+---------------------+--------------+
| Cooling            | 40                              |  None               | 00:00:10     |
+--------------------+---------------------------------+---------------------+--------------+

4. Data Analysis
---------------------------------
#. Data analysis is dependent on experimental design. Refer to the instrument guidelines for more information on how to perform the appropriate data analysis.

.. tip:: 
    For analysis of HEK293T RNA, the following primer pairs can be used for normalization
    ActB: **CTACCTCATGAAGATCCTCACC** and **AGTTGAAGGTAGTTTCGTGGAT**
    GAPDH: **GTATCGTGGAAGGACTCATGAC** and **ACCACCTTCTTGATGTCATCAT**

.. |registered| unicode:: U+00AE
.. |degree| unicode:: U+00B0