ATAC-see

Warning

ATAC-see is a very inefficient procedure, and gives effectively useless results compared to background, even in flow cytometry.

Transposase buffer preparation

Estimated time

1.5 hours.

1. Order the following primers:

   Primer name	Scale	Purification	5’ modification	Sequence
   Tn5ME_rev	25nmol	DSL	Phosphate	CTGTCTCTTATACACATCT
   Tn5ME_A	50nmol	HPLC	Cy5	TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
   Tn5ME_B	50nmol	HPLC	Cy5	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

2. Resuspend each primer separately to 100 uM (the standard stock dilution, nmol * 10 uL).

3. Prepare 1:1 solutions of Tn5ME_rev / Tn5ME_A (A+rev) and Tn5ME_rev / Tn5ME_B (B+rev). Each primer is now at 50 uM.

4. Assemble these double stranded oligos by heating to 95C for 5 minutes, followed by slow cooling to room temperature. To do this on a thermocycler, use a program that does ends after the denaturation step, instead of ending in a hold step.

5. Prepare 5 uM stock solution of Tn5/Cy5. Prepare this either from freshly purified Tn5 in dialysis buffer:

   Component	Volume fraction
   A+rev primers	0.125
   B+rev primers	0.125
   Glycerol	0.4
   Dialysis buffer	0.12
   50 uM Tn5	0.1
   DI H2O	0.13

   If Tn5 is already stored in a 50% glycerol/50% 2x dialysis stock solution at 20 uM, use the following recipe:

   Component	Volume fraction
   A+rev primers	0.125
   B+rev primers	0.125
   Glycerol	0.25
   20 uM Tn5+Glycerol	0.25
   DI H2O	0.25

ATAC-see

We need the following prepared buffers:

• Nuclear permeabilization buffer:

  Component	Concentration	Amount/100 mL final
  Tris-Cl	10 mM	0.1576 g
  NaCl	10 mM	0.058 g
  MgCl2(anhydrous)	3 mM	0.0287 g
  Igepal CA-630	0.01%	10 uL
  HCl	to pH 7.4

• Wash buffer:

  Component	Concentration	Amount/100 mL final
  PBS	Base
  SDS	0.01%	.01 g
  EDTA	50 mM	1.461 g

• 2x TD buffer (from this nature paper):

  Component	Concentration	Amount/L final
  Tris	20 mM	3.264 g
  MgCl2	10 m	0.95 g
  DI H2O	main solvent
  Acetic acid	to pH 7.6, before DMF addition
  Dimethylformamide(DMF)	20% (v/v)

1. After cell fixation, permeabilize cells with lysis buffer for 10 minutes at room temperature.

2. Wash with PBS twice.

3. Prepare transpose mixture:

   Component	Volume fraction
   2x TD buffer	0.5
   5 mM assembled Tn5	0.02
   DI H2O	0.48

4. Add 50 uL of transpose mixture to cells to be transposed. Place the cells in a humid 37C box for 30 minutes.

5. For plated cells, wash with wash buffer three times, for 15 minutes each at 55C. For suspended cells, wash twice.

6. Add PBS media to cells and image/flow the resulting cells.